Systematics of Hydrophylloideae (Boraginaceae)

Posts tagged “systematics

floral diagram

Untitled-1


fried foraging! science fritters

I ate them all, so no photos of the fry-up. I found recipe #357 from Neil Cooks Grigson - and +lemon wedges and olives and some aoili, with Anchor Steam. The comfrey variant is included in the recipe for Clary Fritters [pp. 164, Hannah Glasse's The Art of Cookery]. Fried food is a good thing, so doubleplusgood to eat my research. Science fritters! And in a historically reasonable way.

to_make_clary_fritters

comfrey_leaves

symphytum_officinale


Eutoca multiflora Douglas ex Lindley

Via the Biodiversity Heritage Library and the Missouri Botanical Garden, Peter H. Raven Library. Eutoca multiflora Douglas ex Lindley, Botanical Register [Bot. Reg.] 14: tab. 1180. 1828. “A hardy annual, of great beauty, … resembling some small Echium in appearance”

Eutoca multiflora Douglas ex Lindley_just a taste


explain the output. go back

Explain_the_output


Phacelia sp., what is it?

I didn’t collect a voucher because I didn’t have a permit, and because all I saw was the one plant. It was so weird and I stared at it for an hour and all I wanted to do was kill it for history and it has haunted me for years. It keys out as one currently accepted entity, and can kind of sort of fit a few possible characteristics of the synonyms, but not in any satisfying way, because it really isn’t any of them, and it is so obviously different, you know? I would just like a good way to make sure. Using the SCIENCE. I have seen a couple of photos similar on the internetz, so if you see something that looks like this plant out in the drought fields, make a duplicate voucher and send it my way. Or not, and describe a new species yourself. I will thank you either way, because then there will be an answer. And it will have a name.

what?

what?what?

 


TJM2 Key to Groups Schematic

You can download the schematic used in the Jepson Herbarium Workshop ‘Keying with the second edition of The Jepson Manual’ handout by clicking on the image below [or here .png], or download a PDF suitable for printing as a single page. Note: the font is super small as a single page image! The full 2014 Workshop Handout is available as a PDF download on the Training and Teaching page.

TJM2_KeyToGrps_Schematic_gkw01112014


i prothallus alternation of generations

iprothallusalternationofgenerations

GOING, M. 1899. Field, forest, and wayside flowers; with chapters on grasses, sedges, and ferns; untechnical studies for unlearned lovers of nature. By Maud Going (E.M. Hardinge), illustrated in part with drawings from life by S.G. Porter and photographs by Edwin H. Linco. Baker and Taylor Co., New York, NY. Website http://www.biodiversitylibrary.org/item/117705#page/263/mode/1up (accessed 25 November 2013).

CAS field trip

ScienceScienceScience_and_Rainbows

Trigger in the CAS IZG department

microfossils

CLAUDEandFriends

jellies

the terrestrial to the marine

always, always looking to the sky


Mosasaurus flipper swim

MosasaurusCHOMP


brachiosaurus best friends

brachiosaurus_meat


39th Annual Southern California Botanists Symposium

39th Annual Southern California Botanists Symposium: Origin and Relationships of the California Flora: Was Raven Ravin’? Program PDF link here. Thanks very much to the Southern California Botanists for their incredible generosity for the invitation and for hosting me. They took care of everything, and organized a truly delightful weekend.

Slides [abbreviated and annotated] from my talk titled ‘The problem of being common (Phacelia sect. Ramosissimae)’. The order of slides starts at the top of this post and scrolls down. These are low res jpgs for web viewing, so high res pdfs are available also by request. Any questions about methods or details please contact me.

Slide1

Slide2

Slide3

Slide4

Slide5

Slide6

Slide8

Slide10

Slide11

Slide12

Slide13

Slide14

Slide15

Slide7

Slide16

 


somebody has to do the dishes

photo(1)


OBI

Trigger helping me work at the Robert F. Hoover [OBI] Herbarium.

Trigger helping me work at the Robert F. Hoover Herbarium [OBI].

Practicing my handwriting with annotations of OBI Hydrophylloideae

Practicing my handwriting with annotations of OBI Hydrophylloideae

 


Bodie Mertensia

Mertensia oblongifolia var. nevadensis at Bodie State Park.

Mertensia oblongifolia var. nevadensis in sagebrush scrub at Bodie State Park.

Mertensia oblongifolia var. nevadensis near Dog-faced George's place at Bodie State Park. A white morph in a population of the normals. Other white morphs on Calphotos [

Mertensia oblongifolia var. nevadensis near Dog-faced George’s place at Bodie State Park. A white morph in a population of the normals. Other white morphs on Calphotos [Gary Monroe 1, 2; Mary Winters 1]

 


Knights Ferry

Inflorescences of Phacelia cicutaria. The calyx lobes form little baskets around the capsules when mature. The basket breaks off and rolls away like a mini-tumbleweed. Also, the spiky hairs stick efficiently under my skin.

Inflorescences of Phacelia cicutaria. The calyx lobes form little baskets around the capsules when mature. The basket breaks off and rolls away like a mini-tumbleweed. Also, the spiky hairs stick efficiently under my skin.

Phacelia cicutaria plant, in rock crevice at Tulloch Mill. Dry dry dry.

Phacelia cicutaria plant, in rock crevice at Tulloch Mill. Dry dry dry. Type collected April 9th, 1895 and without fruit or seed, so I thought a later date would be better to capture flowering and fruiting. I was wrong! And this is what being wrong looks like. I need to return earlier and repeatedly throughout the spring next year.

Phacelia cicutaria in middle of rock at south side of Tulloch Mill at Knights Ferry. Type locality for Phacelia cicutaria is probably along the Stanislaus River, but it was so dry even down at the river sides these were the best looking plants I could find. The others were all stripped down skeletons.

Phacelia cicutaria in middle of rock at south side of Tulloch Mill at Knights Ferry. Type locality for Phacelia cicutaria is probably near[er] and along the Stanislaus River ["at Knights Ferry, on the Stanislaus River"], but it was so dry even down at and along the river near Tulloch Mill and the covered bridge that these were the best looking plants I could find. The others were all stripped down skeletons of plants.

The covered bridge at Knights Ferry Rec Area over the Stanislaus River. The General Store in Knights Ferry was closed.

The covered bridge at Knights Ferry Rec Area over the Stanislaus River. The General Store in Knights Ferry was closed. Sads. After scouting around the covered bridge and south without finding green plants I didn’t hike further up or down the river. Next year though!

 

 

 


Martis Valley

Nemophila spatulata, Martis Creek.

Nemophila spatulata, Martis Creek.

 

Hydrophyllum capitatum var. alpinum.

Hydrophyllum capitatum var. alpinum, sagebrush scrub.

Hydrophyllum capitatum var. alpinum, Martis Valley along trail.

Hydrophyllum capitatum var. alpinum, Martis Valley along trail.

 


Drought year

Scouted most of the Phacelia peirsoniana paratype localities [here, Sherwin Summit with Jim Linnberg and Trigger the service dog] and accessible Consortium of California Herbaria specimen sites on this trip based out of UC SNARL. Love that place. Too dry in some places for some of the target species I was looking for [also looked for Phacelia tetramera out on alkali sinks], but there are patches of blooms where precipitation seems to have struck and stuck.

A really good trip, and I wish I could have stayed out another week at least. Next year I hope it rains, and I can go in April and again in May to catch these taxa.

This was also the first trip I had an iPhone and definitely prefer my Nikon for photos. But for planning out a daily botany  itinerary with the Jepson eFlora, Consortium of California Herbaria search results, Google maps, and CalPhotos – I used that iphone nonstop when there was areas with service. Tom Schweich’s area list for Mono County is AWESOME – full of great resources, as is Tim Messick’s Bodie Hills flora.

paratyping


Phacelia monoensis

Phacelia_monoensis


Phacelia [?] var. heliophila

This is why I love nomenclature, I love taxonomy, I love collections, I love digitized archives and libraries offsite, and I love going to the field and finding plants that match protologues. Because even in California, even in 2013, even in Phacelia, there are mysteries and there is disagreement. What is this? I have an idea, but I have to rigorously test it. Stay tuned [and on botany time, so 3+ yrs for data collection, analysis, and publication].

This is why I love nomenclature, I love taxonomy, I love collections, I love digitized archives and libraries offsite, and I love going to the field and finding plants that match protologues. Because even in California, even in 2013, even in Phacelia, there are mysteries and there is disagreement. What is this? I have an idea, but I have to rigorously test it. Stay tuned [and on botany time, so 3+ yrs for data collection, analysis, and publication].


listies-1

Readings

DAVIS, W. 1997. One river: explorations and discoveries in the Amazon rain forest. New York, Simon & Schuster.

KUHN, T. S. 1970. The structure of scientific revolutions. Chicago, University of Chicago Press.

LATOUR, B., and S. WOOLGAR. 1979. Laboratory life: the social construction of scientific facts. Beverly Hills, Sage Publications.

PIRSIG, R. M. 1974. Zen and the art of motorcycle maintenance: an inquiry into values. New York, Morrow.

WOOD, D. 1973. I don’t want to, but I will (IDWTBIW). The genesis of geographic knowledge: a real-time developmental study of adolescent images of novel environments. Dissertation, Cartography, Clark University, Worcester, Mass. http://www.deniswood.net/lp_idwtbiw.htm

Movies

Dark Matter, 2008.

Burden of dreams, 1982. Criterion Collection [http://www.criterion.com/films/546-burden-of-dreams] also available on Hulu Plus [http://www.hulu.com/watch/166742].

Naturally Obsessed: The Making of a Scientist, 2009. http://www.thirteen.org/naturally-obsessed/#.UOHzBL-zBZo

Real genius, 2002.

 


Submission feels so good

It does. It really does.

submissionfeelssogood


How to pick a research project

Choose Your Own Phylogenetic Adventure with a Tree of Life dartboard!

Assemble the Tree of Life Dartboard with the following elements: Dartboard. Circular cladogram printed at scale best suited for game level [grad school, post doc, tenure track] and purpose, attached to dartboard.

Throw your dart. Find your project. Write it up. You win!

Variations include many games previously played with the Magic-8 ball, including ‘how to find a project with full funding’ and ‘how to find a project no one else is/was/will be working on except for me but will totally be finished within my timeframe’. Also the more specific ‘pick the next grant proposal topic’, which may require darting at your own preliminary phylogenetic analyses [thanks CIPRESFigTree v1.3.1]. If playing with others for points [committee members, collaborators, lab members, your future self] you can play blindfolded and have someone else/your future self reassign the bullseye position after each throw.

ChooseYourOwnPhylogeneticAdventure

Tree of life cladogram David M. Hillis, Derrick Zwickl, and Robin Gutell, University of Texas [http://www.zo.utexas.edu/faculty/antisense/DownloadfilesToL.html]

If you thought this was too easy, or were concerned about the sampling in the study or the orientation of the figure on the dartboard – you can also consider your personalized darts heatmap. Like there wasn’t going to be a paper to read, and it wasn’t going to be a statistics paper, and it wasn’t going to have an R package. hahahaha. TIBSHIRANI, R. J., A. PRICE, and J. TAYLOR. 2010. A statistician plays darts. Journal of the Royal Statistical Society: Series A (Statistics in Society) 174(1):213-226. [http://www.stat.cmu.edu/~ryantibs/darts/]

 

 


Humboldt Institute for Interdisciplinary Marijuana Research

HIIMR is brilliant. Brilliant. Brilliant. If only the spring speaker series could be podcast?

The Times Standard news article includes more information, and is slightly more reassuring about the lack of any listed botanists, population geneticists, agronomists, or plant pathologists in the affiliated faculty and research interests on the institute’s homepage. Humboldt State has a world class herbarium [HSC], and a great botany department, this is a perfect synthesis of facilities for future research opportunities. Difficulties for current access, documentation, permits, regulations – I feel that this is a tremendously positive step toward best practices for scientific research on marijuana. Collecting specimens and growing plants of Cannabis for experimental and systematic studies are going to be incredibly important [voucher specimens are the fundamentals of plant biology], and efforts are needed to a] support field research to document rare populations before they are extirpated, b]  study evolutionary relationships using comparative genomics with Humulus, c] understand modern domestication of a plant crop with applied breeding programs, and d] understand gene expression and regulation in chemical synthesis pathways in marijuana. HIIMR should also consider supporting a long term seed bank [okay, achene bank] and clonal germplasm repository for landraces of Cannabis, and possibly partner with Philip Morris to apply results to bring to market a marijuana cigarette.

 

Also, I am interested in a job when I finish my PhD. I will be in touch.

 

 


good amps, great peaks, BLASTN contaminant

>Contig[MLB112]_@11/17/12,_11:22_AM
TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTC
TTCATTGACCTCTCACCCTTCACATCCACATACACCTGTGCACCGTTTGG
CTCTTATAAAAGACGCAAGTCTGCAATGAGAGTCATCAATTTTATACATA
CCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAA
CAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGAT
AAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC
CTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA
CTCTCAACCTTCAACCTTTTTATTAAGGCTGAAGGCTTGGACTTGGGCGC
TGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTT
TGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCA
AGTATGGCCGAGATAAAGGAAGTCTTTAGATCCGCTTCTAATTCTTAGAT
AGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTA
GGACTACCCGCTGA