Bodie Mertensia
Mertensia oblongifolia var. nevadensis in sagebrush scrub at Bodie State Park.
Knights Ferry
Inflorescences of Phacelia cicutaria. The calyx lobes form little baskets around the capsules when mature. The basket breaks off and rolls away like a mini-tumbleweed. Also, the spiky hairs stick efficiently under my skin.
Phacelia cicutaria plant, in rock crevice at Tulloch Mill. Dry dry dry. Type collected April 9th, 1895 and without fruit or seed, so I thought a later date would be better to capture flowering and fruiting. I was wrong! And this is what being wrong looks like. I need to return earlier and repeatedly throughout the spring next year.
Phacelia cicutaria in middle of rock at south side of Tulloch Mill at Knights Ferry. Type locality for Phacelia cicutaria is probably near[er] and along the Stanislaus River ["at Knights Ferry, on the Stanislaus River"], but it was so dry even down at and along the river near Tulloch Mill and the covered bridge that these were the best looking plants I could find. The others were all stripped down skeletons of plants.
The covered bridge at Knights Ferry Rec Area over the Stanislaus River. The General Store in Knights Ferry was closed. Sads. After scouting around the covered bridge and south without finding green plants I didn’t hike further up or down the river. Next year though!
Martis Valley
Nemophila spatulata, Martis Creek.
Hydrophyllum capitatum var. alpinum, sagebrush scrub.
Hydrophyllum capitatum var. alpinum, Martis Valley along trail.
Drought year
Scouted most of the Phacelia peirsoniana paratype localities [here, Sherwin Summit with Jim Linnberg and Trigger the service dog] and accessible Consortium of California Herbaria specimen sites on this trip based out of UC SNARL. Love that place. Too dry in some places for some of the target species I was looking for [also looked for Phacelia tetramera out on alkali sinks], but there are patches of blooms where precipitation seems to have struck and stuck.
A really good trip, and I wish I could have stayed out another week at least. Next year I hope it rains, and I can go in April and again in May to catch these taxa.
This was also the first trip I had an iPhone and definitely prefer my Nikon for photos. But for planning out a daily botany itinerary with the Jepson eFlora, Consortium of California Herbaria search results, Google maps, and CalPhotos – I used that iphone nonstop when there was areas with service. Tom Schweich’s area list for Mono County is AWESOME – full of great resources, as is Tim Messick’s Bodie Hills flora.
Phacelia [?] var. heliophila
![This is why I love nomenclature, I love taxonomy, I love collections, I love digitized archives and libraries offsite, and I love going to the field and finding plants that match protologues. Because even in California, even in 2013, even in Phacelia, there are mysteries and there is disagreement. What is this? I have an idea, but I have to rigorously test it. Stay tuned [and on botany time, so 3+ yrs for data collection, analysis, and publication].](http://www.genevievekwalden.com/wp-content/uploads/2013/03/var_heliophila.jpg)
This is why I love nomenclature, I love taxonomy, I love collections, I love digitized archives and libraries offsite, and I love going to the field and finding plants that match protologues. Because even in California, even in 2013, even in Phacelia, there are mysteries and there is disagreement. What is this? I have an idea, but I have to rigorously test it. Stay tuned [and on botany time, so 3+ yrs for data collection, analysis, and publication].
listies-1
Readings
DAVIS, W. 1997. One river: explorations and discoveries in the Amazon rain forest. New York, Simon & Schuster.
KUHN, T. S. 1970. The structure of scientific revolutions. Chicago, University of Chicago Press.
LATOUR, B., and S. WOOLGAR. 1979. Laboratory life: the social construction of scientific facts. Beverly Hills, Sage Publications.
PIRSIG, R. M. 1974. Zen and the art of motorcycle maintenance: an inquiry into values. New York, Morrow.
WOOD, D. 1973. I don’t want to, but I will (IDWTBIW). The genesis of geographic knowledge: a real-time developmental study of adolescent images of novel environments. Dissertation, Cartography, Clark University, Worcester, Mass. http://www.deniswood.net/lp_idwtbiw.htm
Movies
Dark Matter, 2008.
Burden of dreams, 1982. Criterion Collection [http://www.criterion.com/films/546-burden-of-dreams] also available on Hulu Plus [http://www.hulu.com/watch/166742].
Naturally Obsessed: The Making of a Scientist, 2009. http://www.thirteen.org/naturally-obsessed/#.UOHzBL-zBZo
Real genius, 2002.
How to pick a research project
Choose Your Own Phylogenetic Adventure with a Tree of Life dartboard!
Assemble the Tree of Life Dartboard with the following elements: Dartboard. Circular cladogram printed at scale best suited for game level [grad school, post doc, tenure track] and purpose, attached to dartboard.
Throw your dart. Find your project. Write it up. You win!
Variations include many games previously played with the Magic-8 ball, including ‘how to find a project with full funding’ and ‘how to find a project no one else is/was/will be working on except for me but will totally be finished within my timeframe’. Also the more specific ‘pick the next grant proposal topic’, which may require darting at your own preliminary phylogenetic analyses [thanks CIPRES & FigTree v1.3.1]. If playing with others for points [committee members, collaborators, lab members, your future self] you can play blindfolded and have someone else/your future self reassign the bullseye position after each throw.
Tree of life cladogram David M. Hillis, Derrick Zwickl, and Robin Gutell, University of Texas [http://www.zo.utexas.edu/faculty/antisense/DownloadfilesToL.html]
If you thought this was too easy, or were concerned about the sampling in the study or the orientation of the figure on the dartboard – you can also consider your personalized darts heatmap. Like there wasn’t going to be a paper to read, and it wasn’t going to be a statistics paper, and it wasn’t going to have an R package. hahahaha. TIBSHIRANI, R. J., A. PRICE, and J. TAYLOR. 2010. A statistician plays darts. Journal of the Royal Statistical Society: Series A (Statistics in Society) 174(1):213-226. [http://www.stat.cmu.edu/~ryantibs/darts/]
good amps, great peaks, BLASTN contaminant
>Contig[MLB112]_@11/17/12,_11:22_AM
TCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGAGCGTC
TTCATTGACCTCTCACCCTTCACATCCACATACACCTGTGCACCGTTTGG
CTCTTATAAAAGACGCAAGTCTGCAATGAGAGTCATCAATTTTATACATA
CCCCAGTCTTATGAATGTAACAGTTTTAATAAACATAATAAAACTTTTAA
CAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGAT
AAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC
CTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA
CTCTCAACCTTCAACCTTTTTATTAAGGCTGAAGGCTTGGACTTGGGCGC
TGCTGGTTTTTACTAACCGGCTCGCCTGAAATGAATTAGCAGATCCTTTT
TGTAATCGGTTCCACTCGACGTGATAAGTATTTCGCCGAGGACATACGCA
AGTATGGCCGAGATAAAGGAAGTCTTTAGATCCGCTTCTAATTCTTAGAT
AGAGCTTGCTCTACTAAACCCCATTTTATGATCTGGCCTCAAATCAGGTA
GGACTACCCGCTGA
URAP project deadline extended
The project deadline for the Fall 2012 URAP project has been extended until September 7th at 3pm!
A list of the open and extended projects is available here.
Project description available at the Baldwin URAP project page [here] and and at the link through the title below. Information and application available at the UC Berkeley URAP [Undergraduate Research Apprentice Program] website [http://research.berkeley.edu/urap/index.php].
Phylogenetic relationships and species circumscription of tribe Romanzoffieae (Boraginaceae)
Deadline for this project (only) is extended to Friday, September 7th at 3pm. SPECIAL INSTRUCTIONS: Applicants should enter a URAP application on line. Activate it by submitting paper copy DIRECTLY to the faculty member’s departmental mailbox. Apply as soon as possible because projects may be closed as soon as they are filled. Do not wait until the deadline.
Carthorsing
carthorsing, adj.
1. to work like a cart horse (cart-,horse, n.).
2. to put the cart before the horse (Hysteron Proteron, n., adj., adv., and generally). In the preparation of scientific papers, the practice of drafting conclusive paragraphs from preliminary data analyses. Sometimes used to denote new ideas absent rigorous testing. See also – Speculative Evolution, Future Science.
2010 G. Blumenkohl Bio. Sci. Poesie iii. 21344 Anything after NINJA is open for carthorsing.
2011 Anon. I carthorsed my way into a tree space that I otherwise might not have visited.
New Open Fall 2012 URAP project in the Baldwin lab
New open project in the Baldwin lab for the UC Berkeley URAP [Undergraduate Research Apprentice Program] program for Fall 2012. Project description available at the Baldwin URAP project page [here] and repeated below. Information and application available at the URAP website [http://research.berkeley.edu/urap/index.php].
Phylogenetic relationships and species circumscription of tribe Romanzoffieae (Boraginaceae)
Open. Apprentices needed for the Fall semester. Please do NOT contact faculty before Monday, September 10th (the start of the 4th week of classes)! Enter your application on the web beginning Thursday, August 16th. Activate it by submitting a paper copy and an attached transcript and class schedule at the URAP office by Wednesday, August 29th at 4pm.
Tribe Romanzoffieae is the largest tribe in Hydrophylloideae (Boraginaceae), and has a distributional range extending throughout western North America and temperate South America. Much of the diversity and distributional range in the tribe is due to Phacelia (210 spp.), with the center of diversity for the genus considered to be the California Floristic Province (90 spp., 40 spp. endemic). A small clade is composed of the genera Draperia, Hesperochiron, Howellanthus, and Tricardia – which all occur to some extent in California, with extra-California species distributed throughout western North America. Goals for phylogenetic analysis of this clade includes using molecular techniques to evaluate relationships between described genera in the tribe.
The successful URAP applicant will partner with a Baldwin lab doctoral student to:
1. extract DNA from dried plant material,
2. perform PCR on extracted genomic DNA,
3. prepare PCR amplicons for sequencing and in some cases, perform sequencing themselves,
4. and edit DNA sequences and perform phylogenetic analyses.
5. Other tasks may be developed, as need and interest arise.
In addition, the student will prepare a formal scientific talk and/or poster for presentation at a scientific meeting. Ultimately, the student will partner with the Baldwin lab to draft a peer-reviewed paper.
Day-to-day supervisor for this project: Genevieve Walden, Ph.D. candidate
Qualifications: The student should be:
1. detail-oriented,
2. interested in lab work,
3. available for at least one year [including summer 2013 desirable],
4. available during Fall 2012 to work at least 2 or 3 blocks of 3-4 hours each.
Qualifications: The successful URAP applicant will partner with a doctoral student in the Baldwin lab for all phases of this URAP project, although it is expected that the URAP apprentice will work independently in the lab following in-depth training. The apprentice must be extremely conscientious and detail-oriented, as many plant specimens in the herbaria are old, fragile, of conservation concern, and limited material is available for destructive sampling for this lab work. The successful applicant will have at least 9 hours per week to dedicate to the project, an interest in participating in the program for one full year, previous plant science classes or botany experience [desirable], and willingness to ask questions. In return, the URAP apprentice will gain valuable experience working with a doctoral student on an on-going research project, academic credit (taken for a letter grade), a strong letter of recommendation, and training in scientific presentation skills.
Weekly Hours: 9-12 hrs
Related website: http://ucjeps.berkeley.edu/Baldwin-Lab.html
Exploring species concepts
The first session of the Sawyer Seminar on Speciesism was fantastic. First, selfishly, it was a great review in preparation for the qualifying exam. Second, it was an example of exceptional discussion on some incredibly nuanced topics, and thoughtful positions on all sides of the debate. The presentations were by Dr. Craig Moritz and Dr. Brent Mishler, and the discussions were by Dr. Roberta Millstein, Dr. Robert Proctor and Dr. David Wake. AMAZING.
Prior to the event, we were encouraged to read four papers to prime the discussion, references included below.
ALVAREZ, W. 1991. The gentle art of scientific trespassing. GSA Today 1(2):29-34.
CLARIDGE, M. F. 2009. Species are Real Biological Entities. In Contemporary Debates in Philosophy of Biology: Wiley-Blackwell.
HEY, J., R. S. WAPLES, M. L. ARNOLD, R. K. BUTLIN, and R. G. HARRISON. 2003. Understanding and confronting species uncertainty in biology and conservation. Trends in Ecology and Evolution 18(11):597-603.
MISHLER, B. D. 2009. Species are not Uniquely Real Biological Entities. In Contemporary Debates in Philosophy of Biology: Wiley-Blackwell.
In general, as an overview text that follows the debate format [hence the title], this is a great read – WHEELER, Q., and R. MEIER. 2000. Species concepts and phylogenetic theory : a debate. New York, Columbia University Press.
Most of the species names that I wrote down in my notes were almost all Homo sapiens – although there was a monospecific plant [Gingko - naturally mentioned by Dr. Mishler]. Is that my bias? I will have to pay better attention the next time to the species names discussed. Common names were bandied about frequently [Chimpanzee, Barn owl, salamander, oak, orchid], and I didn’t know if this was a deliberate strategy for initiating the debate, or a result of establishing common points of reference across incredibly diverse disciplines represented. I was trying to remember what the tautonym for one of the owls was, and confused Bufo bufo with Bubo bubo. Dr. Kip Will recommended this great site for ‘Curious Scientific Names’ by Dr. Douglas Yanega [here].
I am definitely looking forward to the next session in May [general schedule available here].
Field Notebooks
Michael Eisen wrote a blog post last year noting a super amazing inclusion of the digitized lab notebooks as part of the supplemental materials [Lang and Botstein 2011]. My lab work has somewhat been on pause with classes [IS290 and IB200A] and studying for orals this semester, but come the end of April – I am going to do this with my lab notebooks as I progress through experiments in the Baldwin genomics lab and the MPL.
Along that vein, I will also put up my field notebooks from this year, probably the whole notebook at the end of the season, and additional notes from individual collection events posted as updates inside posts – this one includes the corolla dissections and sketches of ovules. And yes, after upload I realized that penciled drawings don’t scan as well as inked illustrations – so will keep that in mind for the future.
Posting my field notebooks serves as part organization, part transparency, part scholarship, part archival, part communication, part trying to be a better practitioner of science. I also believe that creating a clear link between the collection event and the accessioned specimen may motivate me to decrease the time between collection and accession, which can contribute to the lag time in species descriptions – not that I am collecting anything new [Bebber et al. 2010].
I benefit so much from reading the online digitized field notebooks of Willis Linn Jepson, Reid Moran and others [the Smithsonian has an entire Field Book Project - AMAZING, go look at it], and visiting archives to read field notebooks of the Cantelows and John Thomas Howell at California Academy of Sciences. Other archives I really would like to visit are those of Marcus E. Jones, because Parry stole my rose [Dorst 2010; Jones 1930].
The field season is slower this year due to drought and next year will be my big field year, but there are still opportunities to describe some of the field diversity in a group like the [mostly Californian] Ramosissimae, which includes Phacelia distans and Phacelia malvifolia. I have been really inspired by the amazing scientific illustrations that John Myers has been doing for the FNANM treatment, and Dr. Strother also encouraged me [in the words of Terry Allen] to practice drawing. I limned the basics from the Phacelia californica that I collected for the Jepson Manual 101 clinic, and pressed the voucher in my Herbarium Supply plant press. I am always interested in best practices for collecting specimens and making vouchers [see one of M.E.Jones writings on collecting here], and not just because it is part of the IS290 class project for the UC Berkeley Botanic Garden!
Literature cited
BEBBER, D. P., M. A. CARINE, J. R. I. WOOD, A. H. WORTLEY, D. J. HARRIS, G. T. PRANCE, G. DAVIDSE, J. PAIGE, T. D. PENNINGTON, N. K. B. ROBSON, and R. W. SCOTLAND. 2010. Herbaria are a major frontier for species discovery. Proceedings of the National Academy of Sciences of the United States of America 107(51):22169-22171.
DORST, D. 2010. The surf guru: stories. New York, Riverhead Books.
JONES, M. E. 1930. Botanical reminiscences. Contributions to Western Botany 17:1-31.
LANG, G. I., and D. BOTSTEIN. 2011. A Test of the Coordinated Expression Hypothesis for the Origin and Maintenance of the GAL Cluster in Yeast. PLoS ONE 6(9):e25290.
Nobody puts Baby in synonymy
Reading for oral qualifying exams. Paraphrasing Ernst Mayr, Dave Lindberg, and Johnny Castle.
